|
Left Crispr |
Right Crispr |
Crispr ID |
1176814955 |
1176814961 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
21:13590744-13590766
|
21:13590778-13590800
|
Sequence |
CCTTTCTCACCATTCTTATTCAA |
AAGTTCTGGCCAGGGCAATCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 60, 2: 995, 3: 12300, 4: 8068} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|