ID: 1176814955_1176814962

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1176814955 1176814962
Species Human (GRCh38) Human (GRCh38)
Location 21:13590744-13590766 21:13590779-13590801
Sequence CCTTTCTCACCATTCTTATTCAA AGTTCTGGCCAGGGCAATCAGGG
Strand - +
Off-target summary {0: 4, 1: 60, 2: 995, 3: 12300, 4: 8068} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!