ID: 1176834566_1176834580

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1176834566 1176834580
Species Human (GRCh38) Human (GRCh38)
Location 21:13781186-13781208 21:13781237-13781259
Sequence CCACCCCCACCTGGCCAGGCAGT TCACTGAAGCAGCTCTTGCTGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 4, 3: 44, 4: 886} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!