ID: 1176838234_1176838242

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1176838234 1176838242
Species Human (GRCh38) Human (GRCh38)
Location 21:13814983-13815005 21:13815026-13815048
Sequence CCCATTACGAAGCTGATTTGTCA TCTTCCAGGCTGAAAGTGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 19, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!