ID: 1176952658_1176952669

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1176952658 1176952669
Species Human (GRCh38) Human (GRCh38)
Location 21:15064927-15064949 21:15064962-15064984
Sequence CCGGGTCGTCCCTGCGCCTCGCC GCCGCCGCCTCCCGAGTTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162} {0: 1, 1: 1, 2: 1, 3: 124, 4: 4680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!