ID: 1176952660_1176952668

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176952660 1176952668
Species Human (GRCh38) Human (GRCh38)
Location 21:15064937-15064959 21:15064961-15064983
Sequence CCTGCGCCTCGCCGCCGCCTCCT CGCCGCCGCCTCCCGAGTTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 610} {0: 1, 1: 1, 2: 2, 3: 118, 4: 1362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!