|
Left Crispr |
Right Crispr |
| Crispr ID |
1176952661 |
1176952669 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:15064943-15064965
|
21:15064962-15064984
|
| Sequence |
CCTCGCCGCCGCCTCCTCCGCCG |
GCCGCCGCCTCCCGAGTTCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 141, 3: 465, 4: 1595} |
{0: 1, 1: 1, 2: 1, 3: 124, 4: 4680} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|