|
Left Crispr |
Right Crispr |
| Crispr ID |
1176952662 |
1176952669 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:15064948-15064970
|
21:15064962-15064984
|
| Sequence |
CCGCCGCCTCCTCCGCCGCCGCC |
GCCGCCGCCTCCCGAGTTCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 64, 2: 1376, 3: 2477, 4: 8374} |
{0: 1, 1: 1, 2: 1, 3: 124, 4: 4680} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|