ID: 1176970282_1176970283

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1176970282 1176970283
Species Human (GRCh38) Human (GRCh38)
Location 21:15257031-15257053 21:15257072-15257094
Sequence CCATACAATATTTAGAGAGACAA TTAAAAAAAAAGACCACTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 97, 4: 943}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!