|
Left Crispr |
Right Crispr |
| Crispr ID |
1176998157 |
1176998159 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:15580155-15580177
|
21:15580182-15580204
|
| Sequence |
CCTGCCGTCTTCTGCAGATAACT |
TCCTTTTGAGAGACAGCTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 181, 1: 197, 2: 163, 3: 130, 4: 293} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|