ID: 1176998157_1176998163 |
View in Genome Browser |
Spacer: 22 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1176998157 | 1176998163 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 21:15580155-15580177 | 21:15580200-15580222 |
Sequence | CCTGCCGTCTTCTGCAGATAACT | CTTGGCCTGTTACTGGGCTTCGG |
Strand | - | + |
Off-target summary | No data | {0: 169, 1: 171, 2: 103, 3: 76, 4: 232} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |