ID: 1177016624_1177016628

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1177016624 1177016628
Species Human (GRCh38) Human (GRCh38)
Location 21:15797569-15797591 21:15797585-15797607
Sequence CCAGCACACCCACACCAAAGGAA AAAGGAAGTTCTAAGTATCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!