ID: 1177119590_1177119595

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1177119590 1177119595
Species Human (GRCh38) Human (GRCh38)
Location 21:17123830-17123852 21:17123862-17123884
Sequence CCATGTCCCATCTGTGTGGGATG ATAGGACTGTTCAACTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 90, 3: 318, 4: 523} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!