ID: 1177157224_1177157243

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1177157224 1177157243
Species Human (GRCh38) Human (GRCh38)
Location 21:17512557-17512579 21:17512605-17512627
Sequence CCGTGAGCATGAGGTCAGAGAAC GTGGGACGGGTGGGTGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180} {0: 1, 1: 0, 2: 3, 3: 52, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!