ID: 1177232732_1177232737

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1177232732 1177232737
Species Human (GRCh38) Human (GRCh38)
Location 21:18343306-18343328 21:18343359-18343381
Sequence CCTCAATGATGGTTTTTAATAGG AGGTAAAATGTGAGGTAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 203} {0: 1, 1: 0, 2: 1, 3: 28, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!