ID: 1177253061_1177253064 |
View in Genome Browser |
Spacer: -10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1177253061 | 1177253064 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:18621797-18621819 | 21:18621810-18621832 |
| Sequence | CCATTACTTCCCAGACCCAGGGC | GACCCAGGGCTTTTTTCCACTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 5, 2: 17, 3: 66, 4: 346} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||