ID: 1177262021_1177262029

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1177262021 1177262029
Species Human (GRCh38) Human (GRCh38)
Location 21:18742080-18742102 21:18742126-18742148
Sequence CCATTATCCTTTATTTATGACCT AAATTCGTAGGAATACAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!