ID: 1177262411_1177262417

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1177262411 1177262417
Species Human (GRCh38) Human (GRCh38)
Location 21:18748465-18748487 21:18748493-18748515
Sequence CCTGGGCCCCTGAGAGTACAGAG CAGTTCCACAGCCACAGCTTCGG
Strand - +
Off-target summary {0: 3, 1: 14, 2: 54, 3: 159, 4: 471} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!