ID: 1177262413_1177262423

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1177262413 1177262423
Species Human (GRCh38) Human (GRCh38)
Location 21:18748472-18748494 21:18748517-18748539
Sequence CCCTGAGAGTACAGAGATACCCA GGCTGCAGCTGTGCCTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 62, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!