ID: 1177276021_1177276032

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1177276021 1177276032
Species Human (GRCh38) Human (GRCh38)
Location 21:18913778-18913800 21:18913829-18913851
Sequence CCTCTTTATTGTCCCCTCTTCTC GAGCTGCCAGTTGCACTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 111, 4: 665} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!