ID: 1177318696_1177318708

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1177318696 1177318708
Species Human (GRCh38) Human (GRCh38)
Location 21:19493628-19493650 21:19493676-19493698
Sequence CCGGCGCTTGCCGGCCAGCGCGA GGCCCGGCACTCGGAGCGGCCGG
Strand - +
Off-target summary No data {0: 5, 1: 69, 2: 434, 3: 513, 4: 506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!