ID: 1177332138_1177332142 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1177332138 | 1177332142 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:19678647-19678669 | 21:19678689-19678711 |
| Sequence | CCTGAATTTAAATGTTGGTCTAT | TCTCCTGGATGATATCCTGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 4, 1: 43, 2: 66, 3: 46, 4: 199} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||