ID: 1177371629_1177371632

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1177371629 1177371632
Species Human (GRCh38) Human (GRCh38)
Location 21:20211422-20211444 21:20211460-20211482
Sequence CCTTACAATATCTGCTTATAAAG ACCAATGTGAATCTTGGACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!