ID: 1177505560_1177505563

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1177505560 1177505563
Species Human (GRCh38) Human (GRCh38)
Location 21:22014173-22014195 21:22014207-22014229
Sequence CCAGTAGCAGGCCAAAAGCTGTC GAGTAGTTATCTGCAGAAGATGG
Strand - +
Off-target summary No data {0: 178, 1: 192, 2: 102, 3: 110, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!