ID: 1177663098_1177663101

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1177663098 1177663101
Species Human (GRCh38) Human (GRCh38)
Location 21:24113507-24113529 21:24113541-24113563
Sequence CCACGAACAAACTTTAAAATGTT GTCAGCAAGTCTCCAGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!