ID: 1177674479_1177674489

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1177674479 1177674489
Species Human (GRCh38) Human (GRCh38)
Location 21:24278878-24278900 21:24278929-24278951
Sequence CCGCAAAAACTCCAGCCATCACA GAGCAAAAGGAGAAGTATTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!