ID: 1177698029_1177698033

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1177698029 1177698033
Species Human (GRCh38) Human (GRCh38)
Location 21:24598831-24598853 21:24598879-24598901
Sequence CCAGACTCTCTGGATTTTAATTT GTGTTATCTCTCATGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!