ID: 1177741762_1177741763

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1177741762 1177741763
Species Human (GRCh38) Human (GRCh38)
Location 21:25162857-25162879 21:25162882-25162904
Sequence CCTTATGAAAAATGTCTTCAGGC TTTATTTTTCTATAAGTATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!