ID: 1177751078_1177751081

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1177751078 1177751081
Species Human (GRCh38) Human (GRCh38)
Location 21:25284616-25284638 21:25284653-25284675
Sequence CCTTGTGGACGAATCATAATGTA CCAGATTGAAAACCTAACTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!