|
Left Crispr |
Right Crispr |
Crispr ID |
1177788221 |
1177788237 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
21:25695453-25695475
|
21:25695504-25695526
|
Sequence |
CCATCGTCATCATGGCCCGTTCT |
CGGGGCGGCCGCGGGGCAGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 414, 1: 1018, 2: 754, 3: 186, 4: 228} |
{0: 1, 1: 4, 2: 98, 3: 1114, 4: 3029} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|