ID: 1177788223_1177788226

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1177788223 1177788226
Species Human (GRCh38) Human (GRCh38)
Location 21:25695468-25695490 21:25695484-25695506
Sequence CCCGTTCTCAATGAGCTGTTGGG TGTTGGGTACACCTCCCAGACGG
Strand - +
Off-target summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130} {0: 1065, 1: 787, 2: 161, 3: 187, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!