ID: 1177788223_1177788231

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1177788223 1177788231
Species Human (GRCh38) Human (GRCh38)
Location 21:25695468-25695490 21:25695495-25695517
Sequence CCCGTTCTCAATGAGCTGTTGGG CCTCCCAGACGGGGCGGCCGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!