ID: 1177810351_1177810354

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1177810351 1177810354
Species Human (GRCh38) Human (GRCh38)
Location 21:25918727-25918749 21:25918763-25918785
Sequence CCTACGCCCACGGAATCGCGCTG CAGTCTGAGATCAAACTGCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!