ID: 1177816644_1177816650

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1177816644 1177816650
Species Human (GRCh38) Human (GRCh38)
Location 21:25985384-25985406 21:25985416-25985438
Sequence CCTCCTCAACATGGGCAGGAATC GCTGAGGGTCTGAAAACAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 18, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!