ID: 1177824751_1177824754

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1177824751 1177824754
Species Human (GRCh38) Human (GRCh38)
Location 21:26069664-26069686 21:26069693-26069715
Sequence CCTCTTTTAGATTCTCCTGGGTA AGACTTAAAATGCCTCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!