ID: 1177836041_1177836048

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1177836041 1177836048
Species Human (GRCh38) Human (GRCh38)
Location 21:26187272-26187294 21:26187304-26187326
Sequence CCAGGCTGATCTCAAACTCCTGG TCCCAAAGTTCAGGGATTGCAGG
Strand - +
Off-target summary {0: 1486, 1: 24770, 2: 91797, 3: 159628, 4: 186051} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!