ID: 1177902553_1177902557

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1177902553 1177902557
Species Human (GRCh38) Human (GRCh38)
Location 21:26934591-26934613 21:26934616-26934638
Sequence CCACAGCACACCACAGGCGAGCA GACATCCATGCCGGGACACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165} {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!