ID: 1177902559_1177902561

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1177902559 1177902561
Species Human (GRCh38) Human (GRCh38)
Location 21:26934626-26934648 21:26934639-26934661
Sequence CCGGGACACACGGAGTACTCAGG AGTACTCAGGCCCGAATGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117} {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!