ID: 1177943726_1177943734

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1177943726 1177943734
Species Human (GRCh38) Human (GRCh38)
Location 21:27442460-27442482 21:27442500-27442522
Sequence CCCAAGATAGCTTAAAAGCAAGT GCATGGACAAAGGTTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 73, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!