ID: 1178062972_1178062974

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1178062972 1178062974
Species Human (GRCh38) Human (GRCh38)
Location 21:28872529-28872551 21:28872549-28872571
Sequence CCTGTCACCTTTCTCTTTCATAG TAGCTAGCTGTTTTATAGATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 302} {0: 1, 1: 0, 2: 2, 3: 7, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!