ID: 1178083718_1178083720

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1178083718 1178083720
Species Human (GRCh38) Human (GRCh38)
Location 21:29092315-29092337 21:29092334-29092356
Sequence CCTCTCTAAAGAGGAGGCAAGAG AGAGGTTTCAATTTCTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 285} {0: 1, 1: 0, 2: 1, 3: 26, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!