ID: 1178099570_1178099578

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1178099570 1178099578
Species Human (GRCh38) Human (GRCh38)
Location 21:29253114-29253136 21:29253144-29253166
Sequence CCTGGCAGAGATTCTCCATGTGG CTGTGTAGCAAACTTTTGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 44, 3: 477, 4: 1522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!