ID: 1178137645_1178137648

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1178137645 1178137648
Species Human (GRCh38) Human (GRCh38)
Location 21:29645984-29646006 21:29646000-29646022
Sequence CCTTGCACATTCCAAAGAGAAGA GAGAAGATTGGCCCCTTGACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 44, 4: 1051} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!