ID: 1178181025_1178181028

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1178181025 1178181028
Species Human (GRCh38) Human (GRCh38)
Location 21:30161764-30161786 21:30161804-30161826
Sequence CCTATCTCCAAACACAGTTGCAT TGAGATCTTTAACATATAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 41, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!