ID: 1178189416_1178189421

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1178189416 1178189421
Species Human (GRCh38) Human (GRCh38)
Location 21:30263447-30263469 21:30263465-30263487
Sequence CCACTTTGGCCAGCAGAGGCATC GCATCTCTGCAGATGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212} {0: 1, 1: 2, 2: 5, 3: 23, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!