ID: 1178261667_1178261676

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1178261667 1178261676
Species Human (GRCh38) Human (GRCh38)
Location 21:31105709-31105731 21:31105758-31105780
Sequence CCTATATCAGTTTGTATCTTAGG GGAGAGCTCTTGGGGATAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!