ID: 1178301698_1178301710

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1178301698 1178301710
Species Human (GRCh38) Human (GRCh38)
Location 21:31458738-31458760 21:31458784-31458806
Sequence CCGGAACAGGAAGGGGAGGGGAG CTACTTCAGCTTAGGTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 84, 4: 495} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!