ID: 1178351017_1178351034

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1178351017 1178351034
Species Human (GRCh38) Human (GRCh38)
Location 21:31873290-31873312 21:31873334-31873356
Sequence CCAGGCACCCGGACCCCGGGACC CCACCCCGCGCGCCCGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 298} {0: 1, 1: 0, 2: 1, 3: 9, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!