ID: 1178381766_1178381771

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1178381766 1178381771
Species Human (GRCh38) Human (GRCh38)
Location 21:32115721-32115743 21:32115745-32115767
Sequence CCTGCCCTAGAGACTTCAGACTT CCATCACCACAGTGGCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 35, 3: 116, 4: 433} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!