ID: 1178408857_1178408869

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1178408857 1178408869
Species Human (GRCh38) Human (GRCh38)
Location 21:32347615-32347637 21:32347668-32347690
Sequence CCCAGCTGCCCAATGTTCTGGAG GACCCCTGCACTAAAGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167} {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!